PyroPrimer: Design PCR and sequencing primers for pyrosequencing assay.

(Restricted to users at Dept of Psychiatry, U of C.)

1. Please give the SNPs with flanking sequence in specified format (DNannotator SNP input format):

or upload data file

2. Adjustable parameters for Primer 3 (Primer3 was adjusted for its internal parameters using the default value)

  • PCR product size range   (amplicon size will be tried for 80-150 firstly, then, 151-200, 201-300... till a good one is found)
  • Primer size: optimal:    min:   max: bp
  • Primer  Tm:  optimal:    min:   max: bp
  • Maximum primer Tm difference
  • Maximum number of polyX in primer

    • Number of candidate primer pairs for each SNP:

    3. Choice of output:

  • List of candidate primers
  • Primer 3 raw input
  • Primer 3 raw output
  • Original output from Pyrosequencing company for sequencing primer design

    • 4. Please specify the email address where the results can be delivered:

    Email address  

    5. Output in gzip compressed format:

    Your email box accepts message size limit of  per message

    If your input data file is from a Mac machine, please be sure to check this box

    After Primers are designed, don't forget that you can check the design by:

    Note: Primers longer than 45 bp, or shorter than 15 bp may require additional cost. 

    Univ2_B: 5’- Biotin- GGGACACCGCTGATCGTTTA -3’ (20 bp), so, the gene-specific primer should < 25bp

    By Tu Nguyen, Chunyu Liu